circad | circRNAs associated with diseases

hsa_circ_0100783
Gene	PCDH9	Organism	Human
Genome Locus	chr13:67750008-67750243:-	Build	hg19
Disease	Immunosenescence	ICD-10	Other immunodeficiencies (D84)
DBLink	Link to database	PMID	26451160
Experimental Method
Sample Type	Tissues	Comparison	29 patients with Cytomegalovirus (CMV) latent carriers by CMV-IgG detection
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward CCATTTTGTGAAGCCATAGAC Reverse CACATAGGTCCGTGGATAGTTT	Statistics	Fold Change : Upregulated pvalue : p<0.05
Citation
Wang, YH, Yu, XH, Luo, SS, Han, H (2015). Comprehensive circular RNA profiling reveals that circular RNA100783 is involved in chronic CD28-associated CD8(+)T cell ageing. Immun Ageing, 12:17.